Exercise 1

(c) 2019 Justin Bois. With the exception of pasted graphics, where the source is noted, this work is licensed under a Creative Commons Attribution License CC-BY 4.0. All code contained herein is licensed under an MIT license.

This document was prepared at Caltech with financial support from the Donna and Benjamin M. Rosen Bioengineering Center.

This exercise was generated from an Jupyter notebook. You can download the notebook here.


Exercise 1.1: Using string methods

In Lesson 7, we wrote a function to compute the reverse complement of a sequence.

a) Write that function again, still using a for loop, but do not use the built-in reversed() function.

b) Write the function one more time, but without any looping.


Exercise 1.2: Longest common substring

Write a function that takes two sequences and returns the longest common substring. A substring is a contiguous portion of a string. For example:

Substrings of ATGCATAT:

TGCA
T
TAT

Not substrings of ATGCATAT:

AGCA              # Skipped T
CCATA             # Added another C
Hello, world.     # Has nothing to do with the input sequence

There may be more than one longest common substring; you only need to return one of them.

The call signature of the function should be

longest_common_substring(s1, s2)

Here are some return values you should get.

Function call Result
longest_common_substring('ATGC', 'ATGCA') 'ATGC'
longest_common_substring('GATGCCATGCA', 'ATGCC') 'ATGCC'
longest_common_substring('ACGTGGAAAGCCA', 'GTACACACGTTTTGAGAGACAC') 'ACGT'


Exercise 1.3: RNA secondary structure validator

In this problem, we will write a function that takes an RNA sequence and an RNA secondary structure and decides if the secondary structure is possible given the sequence. Remember, single stranded RNA can fold back on itself and form base pairs. An RNA secondary structure is simply the list of base pairs that are present. We will represent the base pairs in dot-parentheses notation. For example, a sequence/secondary structure pair would be

0123456789
GCAUCUAUGC
(((....)))

For convenience of discussion, I have labeled the indices of the bases on the top row. In this case, base 0, a G, pairs with base 9, a C. Base 1 pairs with base 8, and base 2 pairs with base 7. Bases 3, 4, 5, and 6 are unpaired. (This structure is aptly called a "hairpin.")

I hope the dot-parentheses notation is clear. An open parenthesis is paired with the parenthesis that closes it. Dots are unpaired.

So, the goal of our function is to check all base pairs present in a secondary structure and see if they are with G-C, A-U, or (optionally) G-U.

a) Write a function to make sure that the number of closed parentheses is equal to the number of open parentheses, a requirement for a valid secondary structure. It should return True if the parentheses are valid and False otherwise.

b) Write a function that converts the dot-parens notation to a tuple of 2-tuples representing the base pairs. We'll call this function dotparen_to_bp(). An example input/output of this function would be:

dotparen_to_bp('(((....)))')

((0, 9), (1, 8), (2, 7))

Hint: You should look at methods that are available for lists. You might find the append() and pop() methods useful.

c) Because of sterics, the minimal length of a hairpin loop is three bases. A hairpin loop is a series of unpaired bases that are closed by a base pair. For example, the secondary structure (.(....).) has a single hairpin loop of length 4. So, the structure ((((..)))) is not valid because it has a hairpin loop of only two bases.

Write a function that verifies that a list of base pairs (as outputted by dotparen_to_bp()) satisfies the minimal hairpin length requirement.

d) Now write your validator function. The function definition should look like this:

def rna_ss_validator(seq, sec_struc, wobble=True):

It should return True if the sequence is commensurate with a valid secondary structure and False otherwise. The wobble keyword argument is True if we allow wobble pairs (G paired with U). Here are some expected results:

Returns True:

rna_ss_validator('GCAUCUAUGC', '(((....)))')
rna_ss_validator('GCAUCUAUGU', '(((....)))') 
rna_ss_validator('GCAUCUAUGU', '(.(....).)')

Returns False:

rna_ss_validator('GCAUCUACGC', '(((....)))')
rna_ss_validator('GCAUCUAUGU', '(((....)))', wobble=False) 
rna_ss_validator('GCAUCUAUGU', '(.(....)).') 
rna_ss_validator('GCCCUUGGCA', '(.((..))).')


Exercise 1.4: Command line exercises

In this problem, you will play around with the command line on your machine and get more familiar with it.

a) Let's play around with some options for the ls command. First cd into a directory that has some interesting files in it (like ~git/bootcamp/command_line_tutorial). Try the following if you are using bash.

ls -F
ls -G    # Might not be as cool with Git Bash on Windows
ls -l
ls -lh
ls -lS
ls -FGLh

You should be able to infer what these different options do, but you should talk with the TAs as well.

Normally, files that begin with a dot (.) are omitted when listing things. They are also generally omitted when you use your OS's GUI-based file handling system (like Finder on Macs). To see them, use ls -a. So, cd into your home directory (you remember how to do that, right?), and then do

ls -a

b) The nuclear option to delete everything in a directory is rm -rf. The r means to delete recursively, and the f means to "force" deletion. I was going to give you an exercise that uses the nuclear option, but I'm not going to do that. So, just forget I said anything. For this part of the problem, I want you to discuss with your neighbor when the nuclear option might be used, and what needs to be in place before exercising it.

c) Try doing this if you are using macOS or Linux:

ls /

What is /? Try cd-ing there and seeing what's in there. Do not delete anything!


Exercise 1.5: Making your .bashrc file

Having a .bashrc file allows you to configure your bash shell how you like.

a) Create a .bashrc file in your home directory. If you already have a .bashrc file, open it up for editing using Jupyter's text editor.

b) It is often useful to alias functions to other functions. For example, I am always worried I will accidentally delete things by accident. I therefore have the following line in my .bashrc file.

alias rm="rm -i"

You should create aliases for commands like ls based on the flags you like to always use. Do the same for rm and mv (I use the -i flag with these). To figure out what flags are available, you can look at the man pages. Asking Google will usually give you the information you need on flags.

If you like, you can use my .bashrc file, available in ~/git/bootcamp/misc/jb_bashrc.

c) Depending on your operating system, your ~/.bashrc file may or may not be properly loaded upon opening a new bash shell. You may, e.g. for new macOS versions, need to explicitly source your .bashrc file in your ~/.bash_profile file. Therefore, you should add the following to the bottom of your ~/.bash_profile file.

if [ -f $HOME/.bashrc ]; then
    . $HOME/.bashrc
fi

Computing environment

In [1]:
%load_ext watermark
%watermark -v -p jupyterlab

CPython 3.7.3
IPython 7.1.1

jupyterlab 0.35.5