{"cells": [{"cell_type": "markdown", "metadata": {}, "source": ["# Exercise 3.2: Longest common substring\n", "\n", "<hr>"]}, {"cell_type": "markdown", "metadata": {}, "source": ["Write a function that takes two sequences and returns the longest common substring. A substring is a contiguous portion of a string.  For example:\n", "\n", "Substrings of `ATGCATAT`:\n", "\n", "    TGCA\n", "    T\n", "    TAT\n", "    \n", "Not substrings of `ATGCATAT`:\n", "\n", "    AGCA              # Skipped T\n", "    CCATA             # Added another C\n", "    Hello, world.     # Has nothing to do with the input sequence\n", "    \n", "There may be more than one longest common substring; you only need to return one of them.\n", "\n", "The call signature of the function should be\n", "\n", "```python\n", "longest_common_substring(s1, s2)\n", "```\n", "\n", "Here are some return values you should get.\n", "\n", "|Function call|Result |\n", "|:---|---:|\n", "|`longest_common_substring('ATGC', 'ATGCA')` | `'ATGC'`|\n", "|`longest_common_substring('GATGCCATGCA', 'ATGCC')` | `'ATGCC'`|\n", "|`longest_common_substring('ACGTGGAAAGCCA', 'GTACACACGTTTTGAGAGACAC')   `|`'ACGT'`|"]}, {"cell_type": "markdown", "metadata": {}, "source": ["<br />"]}], "metadata": {"anaconda-cloud": {}, "kernelspec": {"display_name": "Python 3", "language": "python", "name": "python3"}, "language_info": {"codemirror_mode": {"name": "ipython", "version": 3}, "file_extension": ".py", "mimetype": "text/x-python", "name": "python", "nbconvert_exporter": "python", "pygments_lexer": "ipython3", "version": "3.7.7"}}, "nbformat": 4, "nbformat_minor": 4}